Duplication#
Duplication: a sequence change where, compared to a reference sequence, a copy of one or more nucleotides are inserted directly 3' of the original copy of that sequence.
Syntax#
| Syntax | sequence_identifier ":r." position "dup" |
|---|---|
| Examples |
|
| Explanation of Symbols | |
| |
Notes#
- all variants should be described at the DNA level, descriptions at the RNA and/or protein level may be given in addition
- "positions_duplicated" should contain two different positions, e.g. 123_126 not 123_123.
- the "positions_duplicated" should be listed from 5' to 3', e.g. 123_126 not 126_123.
- by definition, duplication may only be used when the additional copy is directly 3'-flanking of the original copy (a "tandem duplication").
- when a variant can be described as a duplication it must be desribed as a duplication and not as e.g. an insertion (see Prioritization)
- when there is no evidence that the extra copy of a sequence detected is in tandem (directly 3'-flanking) the original copy, the change can not be described as a duplication, it should be described as an insertion (see Insertion).
- inverted duplications are described as insertion (
r.234_235ins123_234inv), not as a duplication (see Inversion)
- for all descriptions the most 3' position possible of the reference sequence is arbitrarily assigned to have been changed (3'rule)
- the 3'rule also applies for changes in single residue stretches and tandem repeats
- NOTE: the exception to the 3'rule for duplications around exon/exon junctions see Duplications does not apply when describing variants based on a RNA reference sequence
Examples#
r.7dup(one nucleotide): the duplication of a "u" at position r.7 in the sequenceacuuacu. NOTE: it is not allowed to describe the variant asugccr.6_7insu(see prioritisation)r.6_8dup(several nucleotides): a duplication from position r.6 to r.8 in the sequenceacaauugc. NOTE: it is allowed to describe the variant asugccg.6_8dupugc.
Discussion#
Why do we not describe a duplication as an insertion?
Although duplications are basically a special type of insertion, there are several reasons why the recommendation is to describe duplications separately
- the description is simple and shorter
- it is clear and prevents confusion regarding the position when an insertion is incorrectly reported like "22insg"
How should I describe the change aucg to aucgaucgaucagggucccaucg? The fact that the inserted sequence (aucgaucgauc) is present in the original sequence suggests it derives from a duplicative event.aucgaucgaucaaucgaucgaucggguccc
The variant should be described as an insertion; r.17_18ins5_16. A description using "dup" is not correct since, by definition, a duplication should be directly 3'-flanking of the original copy (in tandem). Note that the description given still makes it clear that the sequence inserted between r.17 and r.18 is probably derived from nearby, i.e. position r.5 to r.16, and thus likely derived from a duplicative event.