Complex (HGVS/ISCN)#
Complex: a sequence change where, compared to a reference sequence, a range of changes occur that can not be described as one of the basic variant types (substitution, deletion, duplication, insertion, inversion, deletion-insertion, or repeated sequence).
Description#
Sequence changes can be very complex, involving a range of changes at one specific location. Complex changes, including translocations, are described using the recommendations of the accepted HGVS nomenclature named extension ISCN, based on the original proposal SVD-WG004 (ISCN<>HGVS). The named ISCN extension has been developed in collaboration with Standing Committee on Human Cytogenomic Nomenclature (ISCN), covering the description of numerical and structural chromosomal changes detected using microscopic and cytogenetic techniques. It should be noted there is a basic difference between ISCN and HGVS: while ISCN describes the structure of the resulting chromosome(s), HGVS describes the variant(s) detected. It should be noted that the description of complex changes can become rather complicated and at some point, although literally correct, becomes effectively meaningless.
The named ISCN extension has been introduced in 2016 and was modified last in May 2020.
-
only aberrant findings, linked to defined chromosomal positions, are described.
-
each rearranged chromosome is described in a separate line.
-
X,Y,1,2,3, ...,21,22
changes affecting sex chromosomes (X then Y) are listed first, followed by those affecting autosomes (numbers from low to high).
NOTE: changed in ISCN2020. ISCN2016 had: aberrations affecting autosomes are listed first (numbers from low to high), followed by those affecting sex chromosomes (X then Y). -
specific symbols
-
pter,cen,qter
the start of the chromosome is described aspter, the end asqter, and the centromere ascen.(pter)_#and#_(qter)
for deletions extending from a known nucleotide position (#) to an unknown position in the direction of the telomere the format(pter)_#or#_(qter)is used.
NOTE: added in ISCN2020.
-
sup
the presence of an additional sequence which is not attached to other chromosomal material (i.e. trisomy, marker or ring chromosome) is indicated bysup(supernumerary chromosome).
NOTE: changed in ISCN2020. ISCN2016 had: "add" for additional sequence. -
::
a double colon is used to designate break point junctions creating a ring chromosome.
NOTE:::changed in ISCN2020. ISCN2016 had: is used to designate break point junctions involving sequences from different chromosomes (translocation, transposition), chromothripsis break point junctions and junctions creating a ring chromosome.
NOTE:::is also used to designate adjoined transcripts.
-
-
chromosomal banding patterns are translated to genomic coordinates based the translation tables provided by NCBI (see Standards).
-
in ISCN, it is allowed to describe nucleotide positions using commas to indicate thousands and millions (e.g., "108,111,982"). In HGVS, this is not allowed.
-
3'rule
to determine the location of the break point, the general HGVS rule of maintaining the longest unchanged sequence applies (the 3' rule). Break point location is determined by the first break point encountered, i.e.pterof the chromosome is to be listed first.-
pter to qter
multiple breakpoints in one chromosome are listed in order of occurrence fromptertoqter. -
variant descriptions are always in the forward orientation (from
ptertoqter, the end of the chromosome), determined by the chromosomal origin of the intact centromere (cen).
-
Examples#
The description of translocations has changed.
In the original proposal (SVD-WG004), one identical derivative chromosome would receive two different descriptions, depending on whether it was identified in a balanced or an unbalanced case.
In a balanced case, the description would use a "::" format joining the breakpoints, while in an unbalanced case, the description would use a "delins" format.
HGVS recommendations try to avoid such conflicts wherever possible.
HGVS, therefore, recommends to describe translocations exclusively using a "delins" format.
-
translocations
-
balanced
-
t(2;11)(p25.1;p15.2)
(involving short arms chromosomes 2 and 11)-
NC_000002.12:g.pter_8247756delins[NC_000011.10:g.pter_15825272]
NC_000011.10:g.pter_5825272delins[NC_000002.12:g.pter_8247756]
NOTE: corrected forNC_000002.12:g.pter_8247756::NC_000011.10:g.15825273_cen_qterandNC_000011.10:g.pter_15825272::NC_000002.12:g.8247757_cen_qterin ISCN2016. -
ISCN
chr2:g.pter_8,247,756::chr11:g.15,825,273_cen_qter(der11) andchr11:g.pter_15,825,272::chr2:g.8,247,757_cen_qter(der2).
-
-
t(2;11)(q31.1;q22.3)
(involving long arms chromosomes 2 and 11, with 5 bp deletion of chr11 sequence)-
NC_000002.12:g.17450009_qterdelins[NC_000011.10:g.108111987_qter]
NC_000011.10:g.108111982_qterdelins[NC_000002.12:g.17450009_qter] -
ISCN
chr2:g.pter_cen_174500098::chr11:g.108111987_qter(der2) andchr11:g.pter_cen_108111981::chr2:g.174500099_qter(der11).
NOTE: couplingchr11:108111981to108111987implies nucleotides108111982_108111986are deleted.
-
-
t(3;14)(14qter->14q12::3p22.2->3qter;14pter->14q12::3p22.2->3pter)
(between short arm chromosome 3 and long arm chromosomes 14, with an inserted sequence at the break point on the derivative chromosome 3)-
NC_000003.12:g.pter_36969141delins[CATTTGTTCAAATTTAGTTCAAATGA;NC_000014.9:g.29745314_qterinv]
NC_000014.9:g.29745314_qterdelins[NC_000003.12:g.36969141_pterinv] -
ISCN
chr14:g.pter_cen_29,745,313::chr3:g.pter_36,969,141inv(der14) andchr14:g.29,745,314_qterinv::CATTTGTTCAAATTTAGTTCAAATGA::chr3:g.36,969,142_cen_qter(der3).
-
-
NC_000009.12:g.pter_26393001delins102425452_qterinv
NC_000009.12:g.102425452_qterdelinspter_26393001inv
for ISCNt(9;9)(9qter->9q22.33::9p21.2->9qter;9pter->9q22.33::9p21.2->9pter)
(between homologous chromosomes, based on Ordulu et al. example)
-
-
unbalanced
-
NC_000002.12:g.pter_8247756delins[NC_000011.10:g.pter_15825266]
for ISCNder(2)t(2;11)(p25.1;p15.2)
(derivative chromosome 2, translocation between short arms chromosomes 2 and 11) -
NC_000003.12:g.158573187_qterdelins[NC_000008.11:g.(128534000_128546000)_qter]
for ISCNder(3)(3pter->3q25.32::8q24.21->8qter)
(derivative chromosome 3, translocation between long arms chromosomes 3 and 8, with an estimated nucleotide range for the break point on chromosome 8, based on uncertain break point localization example from Ordulu et al. example) -
NC_000005.10:g.29658442delins[NC_000010.11:g.67539995_qterinv]
for ISCNder(5)t(5;10)(p13.3;q21.3)
(derivative chromosome 5, translocation between short arm chromosome 5 and long arm chromosome 10 with homology at the break point (chr5 29658440_29658442 and chr10 67539995_67539997), based on Homology examples in Ordulu et al. example)
-
-
-
inversion, pericentric
-
NC_000006.12:g.[776788_93191545inv;93191546T>C]
for ISCNinv(6)(pter->p25.3::q16.1->p25.3::q16.1->qter)
(with substitution at break point) -
NC_000002.12:g.[32310435_32310710del;32310711_171827243inv;insG]
for ISCNinv(2)(pter->p22.3::q31.1->p22.3::q31.1->qter)dn
(de novo, with 275 bp deletion and 1 bp insertion at break points)
NOTE: the HGVS description does not include the de novo occurrence of the variant.
-
-
deletion
-
NC_000023.11:g.(86200001_103700000)del
for ISCNdel(X)(q21.31q22.2)
(within a chromosome, breakpoint not sequenced) -
NC_000022.11:g.pter_(12200001_14700000)del::(37600001_410000000)_qterdel
for ISCNr(22)(p11.1q13.1)
(ring chromosome derived from chromosome 22, breakpoint not sequenced)
NOTE: "::" is used to indicate the join, instead of ";" to describe two not connected deletions.
-
-
insertion
-
duplication (tandem)
-
NC_000008.11:g.(127300001_131500000)_(131500001_136400000)dup
for ISCNdup(8)(q24.21q24.22)
(within a chromosome, breakpoint not sequenced) -
NC_000008.11:g.(131500001_136400000)ins(127300001_131500000)_(131500001_136400000)inv
for ISCNdup(8)(q24.22q24.21)
(within a chromosome, orientation reversed relative to original sequence, breakpoint not sequenced)
-
-
insertion
NC_000004.12:g.134850793_134850794ins[NC_000023.11:g.89555676_100352080inv]
for ISCNder(4)ins(4;X)(q28.3;q22.2q21.31)
(inserted sequence reversed in orientation relative to chromosome sequence containing centromere)
-
transposition
-
balanced (deletion + insertion elsewhere)
-
NC_000004.12:g.134850793_134850794ins[NC_000023.11:g.89555676_100352080]andNC_000023.11:g.89555676_100352080del
for ISCNins(4;X)(q28.3;q21.31q22.2)
(balanced intrachromosomal, inserted sequence same orientation as chromosome sequence containing centromere, based on Ordulu et al. Fig.1C) -
NC_000004.12:g.134850793_134850794ins[NC_000023.11:g.89555676_100352080inv]andNC_000023.11:g.89555676_100352080del
for ISCNins(4;X)(q28.3;q22.2q21.31)
(balanced intrachromosomal, inserted sequence reversed in orientation relative to chromosome sequence containing centromere)
-
-
unbalanced (copy inserted elsewhere)
describe as an insertion.
-
-
-
supernumerary chromosome
NC_000022.11:g.[pter_(12200001_14700000)del::(37600001_410000000)_qterdel]sup
for ISCN+r(22)(p11.1q13.1)
(supernumerary ring chromosome derived from chromosome 22, breakpoint not sequenced)
NOTE: changed in ISCN2020. ISCN2016 had: "add" for additional sequence.
Discussion#
Is the description NM_004006.1:c.123+45_123+51TSDinsL1.603bp acceptable (TSD = target site duplication, insL1 indicates the nature of the insert (L1, Alu or SVA), 603bp = the number of inserted base pairs)?
No, not really, it is not exact.
Following HGVS recommendations, the description should be like NG_012232.1(NM_004006.2):c.123+51_123+52ins[[XXXXXX.y:g.393_1295];123+45_123+51].
So, give a genomic reference sequence to describe the intronic variant, give the site of the inserted sequence, exactly describe the inserted sequence (not like "insL1.603bp") and describe the target site duplication as an insertion (not "TSD"; by definition a duplication is only used when the duplicate sequence is inserted directly 3' of the original copy of that sequence).
In the example, XXXXXX.y is a GenBank file (accession.version number), containing the inserted L1 sequence (nucleotides g.393_1295).
When the inserted sequence is not known, its (estimated) size can be used, like NG_012232.1(NM_004006.2):c.123+51_123+52ins[N[603];123+45_123+51].