Duplication#
Duplication: a sequence change where, compared to a reference sequence, a copy of one or more nucleotides is inserted directly 3' of the original copy of that sequence.
Syntax#
| Syntax | sequence_identifier ":r." position "dup" |
|---|---|
| Examples |
|
| Explanation of Symbols | |
| |
Notes#
- all variants should be described on the DNA level; descriptions on the RNA and/or protein level may be given in addition.
positions_duplicatedshould contain two different positions, e.g.,123_126, not123_123.- the
positions_duplicatedshould be listed from 5' to 3', e.g.,123_126, not126_123. - by definition, duplication may only be used when the additional copy is directly 3'-flanking of the original copy (a "tandem duplication").
- when a variant can be described as a duplication, it must be described as a duplication and not as e.g., an insertion (see Prioritization).
- when there is no evidence that the extra copy of a sequence detected is in tandem (directly 3'-flanking the original copy), the change can not be described as a duplication, it should be described as an insertion (see Insertion).
- inverted duplications are described as an insertion (
r.234_235ins123_234inv), not as a duplication (see Inversion).
- for all descriptions, the most 3' position possible of the reference sequence is arbitrarily assigned to have been changed (3'rule).
- the 3'rule also applies for changes in single residue stretches and tandem repeats.
- NOTE: the exception to the 3'rule for duplications around exon/exon junctions (see Duplications) does not apply when describing variants based on an RNA reference sequence.
Examples#
-
r.7dup(one nucleotide)
the duplication of auat positionr.7in the sequenceacuuacuugcc.
NOTE: it is not allowed to describe the variant asr.6_7insu(see prioritisation). -
r.6_8dup(several nucleotides)
a duplication from positionr.6tor.8in the sequenceacaauugcugcc.
NOTE: the recommendation is not to describe the variant asr.6_8dupugc, i.e., describe the deleted nucleotide sequence.
Discussion#
Why do we not describe a duplication as an insertion?
Although duplications are basically a special type of insertion, there are several reasons why the recommendation is to describe duplications separately.
- the description is simple and shorter;
- it is clear and prevents confusion regarding the position when an insertion is incorrectly reported, like
c.22insG; - insertion more or less means "coming from elsewhere". Mechanistically, a duplication is most likely caused by a local event, DNA polymerase slippage, duplicating a local sequence.
How should I describe the change aucgaucgaucgaucgaggguccc to aucgaucgaucgaucgaaucgaucgaucgggguccc? The fact that the inserted sequence (aucgaucgaucg) is present in the original sequence, suggests it derives from a duplicative event.
The variant should be described as an insertion; r.17_18ins5_16.
A description using "dup" is not correct since, by definition, a duplication should be directly 3'-flanking of the original copy (in tandem).
Note that the description given still makes it clear that the sequence inserted between r.17 and r.18 is probably derived from nearby, i.e. positions r.5 to r.16, and thus likely derived from a duplicative event.