Frameshift#
Frameshift: a sequence change between the translation initiation (start) and termination (stop) codon where, compared to a reference sequence, translation shifts to another reading frame.
Syntax#
| Long format when stop codon position is known | |
|---|---|
| Syntax | sequence_identifier ":p." aa_position "fs" [ "Ter" position ] |
| |
| Examples |
|
| Explanation of Symbols | |
| |
Notes#
- all variants should be described on the DNA level; descriptions on the RNA and/or protein level may be given in addition.
- predicted consequences, i.e. without experimental evidence (no RNA or protein sequence analysed), should be given in parentheses, e.g.,
p.(Arg123LysfsTer34). - for all descriptions, the most C-terminal position possible of the reference sequence is arbitrarily assigned to have been changed (3'rule).
- frameshifts are a special type of amino acid deletion/insertion which, by definition, do not include the deletion from the site of the change to the C-terminal end of the protein (translation termination (stop) codon), like
Arg123_Leu833del, nor the amino acid sequence inserted.- the description of a frameshift starts with the first new amino acid, this might not be first codon affected by the variant on the DNA level.
- the position of the translation termination (stop) codon in the new reading frame is calculated starting at the first amino acid changed by the frameshift (codon 1), and ending at the first stop codon encountered (
Ter#or*#).
NOTE: the number of amino acids in the new C-terminal sequence is "#-1" amino acids.
NOTE: the shortest frameshift variant possible containsfsTer2; variants which introduce an immediate translation termination (stop) codon are described as nonsense variant, e.g.,p.Tyr4Ter(orp.Tyr4*) notp.Tyr4TerfsTer1(see Substitution). - frameshifts can also be described using a short format;
p.Arg123fs, i.e. indicating the first amino acid changed, its position andfswithout further detail.
- the (predicted) amino acid changes of additional variants on the same allele (in cis) downstream of the frameshift are not described unless they change the amino acid sequence or length of the shifted reading frame (i.e. introduce an amino acid substitution, an earlier translational termination (stop) codon or affect the termination codon of the shifted frame).
- deletions starting 5' of and including the translation termination (stop) codon are described as frameshift.
- inserted sequences on DNA or RNA level that
- extend the amino acid sequence at the C-terminal end with one or more amino acids are described as an Extension.
- encode a translation stop codon in the inserted sequence are on the protein level described as an insertion of this sequence, not as a deletion-insertion removing the entire C-terminal amino acid sequence.
- encode an open reading frame which after the inserted sequence shifts to another reading frame, are described as a frameshift.
Examples#
-
p.Arg97ProfsTer23(shortp.Arg97fs) /p.Arg97Profs*23
a variant withArg97as the first amino acid changed, shifting the reading frame, replacing it for aProand terminating at positionTer23. -
p.(Tyr4*)
the predicted consequence on the protein level is aTyrto translation termination codon. This might arise from ac.12deldeletion inATGGATGCATACGTCACGto create aTAGstop codon.
NOTE: the variant is described as a substitution, not as a frameshift (p.Tyr4TerfsTer1). -
p.Glu5ValfsTer5(shortp.Glu5fs)
the predicted consequence on the protein level of the variantATGGATGCATACGAGATGAGGtoATGGATGCATACGTGCATACGAGATGAGG(c.6_13dup). -
p.Ile327Argfs*?(shortp.Ile327fs)
the predicted consequence of a frameshifting variant changesIle327to anArg, but the new reading frame does not encounter a new translation termination (stop) codon. -
p.Gln151Thrfs*9(notp.His150Hisfs*10)
the first codon on the DNA level affected by a variant isHis150and the shifted frame starts with aHisThrSer. Since frameshift variants start with the first amino acid changed, the descriptionp.His150HisfsTer10(orp.His150Hisfs*10) is not correct.
Discussion#
What do you mean with "variants should be described on the protein level and not incorporate knowledge regarding the change on the DNA-level"?
It means that protein variant descriptions should be derived from comparing the variant protein sequence with the reference protein sequence.
Knowledge on the underlying change on the DNA level should not be used.
For example, when MetTrpSerSerSerHisAsp.. changes to MetTrpSerSerHisAsp.., this is described as p.Ser5del.
The information that on the DNA level the change is ..ATGTGGTCCAGTTCCCACGAT.. to ..ATGTGGTCCTCCCACGAT.., so the codon for Ser4 is deleted, is not used; the description p.Ser4del is not correct.